18SrRNA Metabarcoding

This protocol is based on the 2015 Ocean Sampling Day Protocol, which is available on the Ocean Sampling Day website and uses the Nextera DNA Library Prep Reference Guide.

Materials:

Procedures:

1- Amplification of V4 18S rRNA

  1. Retrieve genomic material from freezer and put in fridge to thaw.
  2. Get reagents for master mix from freezer.
  3. Use V4_18SNext.For & V4_18SNext.Rev primers. Primer stocks should be diluted.

 

Primer Label

Primer Sequence(5'-3')

V4_18SNext.For

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

[CCAGCASCYGCGGTAATTGG]

V4_18SNext.Rev

GTCTCGTGGGCTCGGAGATCTGTATAAGAGACAG

[ACTTTCGTTCTTGATYRATGA]

 

  1. Let everything thaw on bench. Put dNTPs and primers back on ice after they have thawed.
  2. Label 96 well plate. Make plate map of where each sample is placed in 96-well PCR plate.
  3. Vortex & spin down everything. Put all components back on ice.
  4. Set up PCR reaction:

 

PCR Reaction

Concentration

Volume

x28

ddH2O

 

13.5 ul

378 ul

V4_18SNext.For

0.5 uM

1.25 ul

35 ul

V4_18SNext.Rev

0.5 uM

1.25 ul

35 ul

dNTPs

200 uM (0.2mM)

2.5 ul

70 ul

5x HF DNA Buffer

1x

5 ul

140 ul

Phusion DNA Polymerase

1 U

0.5 ul

14 ul

DNA template

2.5 ng

1 ul

28 ul

Total

25 ul

25 ul

700 ul

 

  1. Briefly centrifuge PCR plate.
  2. Place PCR plate in Thermal Cycler. PCR should run for about one hour.

 

Cycle

1

10 15 1 1

Temp

98.8

98.0 44.0 72.0 98.0 62.0 72.0 72.0 10.0

Time

0:30

0:10 0:30 0:15 0:10 0:30 0:15 7:00 N/A

 

Run Gel

  1. Prepare 1.2% agarose gel and gel dye red.
  2. Protocol: 8 minutes at 110V. Should yield 470 bp PCR product.

 

Bead Clean, Qubit & Dilute

  1. Clean the samples with KAPA Pure Beads following the manufacturer’s instructions.
  2. Use Qubit protocol to record new concentrations of the samples.
  3. Calculate ul of each sample required to reach 40 ng for next PCR.

 

2- Illumina Nextera Procedure:

Amplification of Index Adapters

1. Retrieve genomic material.

2. Prepare consumables:

 

Item

Instructions

Index adapters (i7 and i5)

Thaw on ice for ~20 mins. Gently invert 3-5 times and centrifuge briefly.

5x HF Buffer

Thaw and immediately place on ice.

Phusion DNA Polymerase

Thaw and immediately place on ice.

 

3. Use 1.7 ml tubes for adapters on the microcentrifuge. Index adapter sequences:

 

Index 1 (i7)

Sequence

Index 2 (i5)

Sequence

N701

TAAGGCGA

N502

CTCTCTAT

N702

CGTACTAG

N503

TATCCTCT

N703

AGGCAGAA

N504

AGAGTAGA

N704

TCCTGAGC

N505

GTAAGGAG

N705

GGACTCCT

N506

ACTGCATA

N706

TAGGCATG

N507

AAGGAGTA

N707

CTCTCTAC

N508

CTAAGCCT

 

4. Label 96 well plate. Make plate map of where each sample is placed in 96-well PCR plate.

5. Vortex & spin down everything except adapters. Put all components back on ice.

6. Indicate placement of dual-indexing adapters. Arrange Index 1 (i7) adapter along columns 1-6 and Index 2 (i5) adapters along rows A-D.

 

 

1

2

3

4

5

6

A

N701

N502

N702

N502

N703

N502

N704

N502

N705

N502

N706

N502

B

N701

N503

N702

N503

N703

N503

N704

N503

N705

N503

N706

N503

C

N701

N504

N702

N504

N703

N504

N704

N504

N705

N504

N706

N504

D

N701

N505

N702

N505

N703

N505

N704

N505

N705

N505

N706

N505

 

7. Set up PCR reaction:

 

PCR Reaction

Concentration

Volume

x28

ddH2O

varies

x ul

x ul

Index 1 (i7)

5 ul

5 ul

140 ul

Index 2 (i5)

5 ul

5 ul

140 ul

dNTPs

 0.2mM

5 ul

140 ul

5x HF DNA Buffer

1x

10 ul

280 ul

Phusion DNA Polymerase

1 U

1 ul

28 ul

DNA template

40 ng

x ul

x ul

Total

50 ul

50 ul

1400 ul

 

8. Pipette ddH2O, Index 1, Index 2, master mix, and DNA in each well.

9. When transferring 40 ng of cleaned PCR product from original 18S amplification, pipette up and down 3-5 times to mix.

10. Briefly centrifuge PCR plate.

11. Place PCR plate in Thermal Cycler. PCR should run for 25 minutes.

 

Cycle 1 5 1
Temp 98.0 98.0 65.0 72.0 10.0
Time 0:30 0:10 0:30 3:00 N/A

 

12. The dual indexed amplicons should be 536 bp for V4.

 

Bead Clean & Qubit PCR-amplified DNA

  1. Clean the amplicon pool with KAPA Pure Beads following the manufacturer’s instructions.
  2. Use Qubit protocol to record new concentrations of the samples.

 

Run Gel

  1. Prepare gel with ladder.
  2. Protocol: 40 minutes at 100V with DNA Hi-Lo Ladder.

 

Pool Samples

  1. Based on Qubit concentrations, calculate the relative concentrations of each sample (nM).
  2. Pool the samples so that equimolar ratios of each amplicon are contributed from each sample.
  3. Qubit the pooled sample before evaporation/dilution.

 

MiSeq

  1. Sample must be 2.0 nM to run on the MiSeq platform.
  2. Use a V2 500 cycle kit.
  3. 20-30% PhiX to increase diversity.

Comments: